Stem-loop sequence ame-mir-927b

AccessionMI0016206 (change log)
DescriptionApis mellifera miR-927b stem-loop
Literature search

1 open access papers mention ame-mir-927b
(1 sentences)

Stem-loop
   -     ca  ------g    -   u        uu      u           --u    c 
5'  uucga  gu       uguu acg uauuuauu  agaauu guacgcucugu   guca a
    |||||  ||       |||| ||| ||||||||  |||||| |||||||||||   ||||  
3'  gaguu  ca       acaa ugc gugaauaa  ucuuag caugcgagaca   uagu a
   g     cc  acuauua    c   u        uu      c           cuu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 2777103-2777218 [+]
intergenic
Database links

Mature sequence ame-miR-927b-5p

Accession MIMAT0018576
Sequence

25 - 

uuuuagaauuuguacgcucugu

 - 46

Get sequence
Evidence experimental; SOLID [1], Illumina [2-3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).