Stem-loop sequence gma-MIR391

AccessionMI0016521 (change log)
DescriptionGlycine max miR391 stem-loop
Literature search

2 open access papers mention gma-MIR391
(10 sentences)

Stem-loop
              c        g    c    u ---      a ccau    g   c 
5' aagguuugcua gcaggaga auga gcug c   ccuugc c    ccua cuu c
   ||||||||||| |||||||| |||| |||| |   |||||| |    |||| ||| c
3' uuccaaaugau cguccucu uacu cgac g   ggaacg g    ggau gag u
              a        a    a    c acc      a -aau    -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 42292832-42292941 [+]
intergenic
Database links

Mature sequence gma-miR391-5p

Accession MIMAT0018280
Previous IDsgma-miR4376
Sequence

10 - 

uacgcaggagagaugacgcugu

 - 31

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence gma-miR391a-3p

Accession MIMAT0020951
Sequence

82 - 

agcaucauaucuccugcauag

 - 102

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).