Stem-loop sequence gma-MIR171c

AccessionMI0016575 (change log)
DescriptionGlycine max miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171c
(41 sentences)

Stem-loop 
       g   u  a        ug             -- g    u     aug 
5' uuaa aac ug gauauugg  cgguucaaucaga  a gcag guuuu   a
   |||| ||| || ||||||||  |||||||||||||  | |||| |||||    
3' aguu uug ac cuauaacc  gccgaguuaguuu  u uguc cgaaa   u
       a   u  a        gu             au g    u     acc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 43625963-43626066 [-]
intergenic
Database links

Mature sequence gma-miR171c-5p

Accession MIMAT0018334
Previous IDsgma-miR171c
Sequence

12 -  

agauauuggugcgguucaauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR171c-3p

Accession MIMAT0022972
Sequence

75 -  

uugagccgugccaauaucaca

 - 95

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).