Stem-loop sequence hsa-mir-4490

AccessionMI0016852 (change log)
Symbol HGNC:MIR4490
DescriptionHomo sapiens miR-4490 stem-loop
Stem-loop 
   a         ca              g    a      gaa 
5'  uaguuucug  augcucaaaucucu gcca agacca   c
    |||||||||  |||||||||||||| |||| ||||||    
3'  aucaaagau  uacggguuuagaga uggu ucuggu   u
   a         ua              a    c      aau
Get sequence
Deep sequencing
18 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 90555774-90555857 [-]
antisense
OTTHUMT00000421431 ; RP11-660M18.2-004; intron 3
OTTHUMT00000421430 ; RP11-660M18.2-003; intron 4
OTTHUMT00000421420 ; RP11-660M18.2-001; intron 4
OTTHUMT00000421432 ; RP11-660M18.2-005; intron 4
ENST00000562678 ; DISC1FP1-004; intron 3
ENST00000562245 ; DISC1FP1-003; intron 4
ENST00000561596 ; DISC1FP1-001; intron 4
ENST00000563681 ; DISC1FP1-005; intron 4
Database links

Mature sequence hsa-miR-4490

Accession MIMAT0019025
Sequence

52 -  

ucugguaagagauuugggcaua

 - 73

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).