Stem-loop sequence pma-let-7a-1

AccessionMI0017144 (change log)
DescriptionPetromyzon marinus let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u    -  u      uu        a              --------     c   ca 
5'  gugg gc ccuggg  gagguagu gguuguauaguuua        agggg aga  u
    |||| || ||||||  |||||||| ||||||||||||||        ||||| |||   
3'  cgcu cg ggaccc  uuccguca ccgacguaucgaau        uuccc ucu  u
   -    u  -      -u        a              agaggcua     u   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL482754.1: 264479-264586 [-]
intergenic
Database links

Mature sequence pma-let-7a

Accession MIMAT0019564
Sequence

16 - 

ugagguaguagguuguauaguu

 - 37

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).