Stem-loop sequence pma-let-7b

AccessionMI0017148 (change log)
DescriptionPetromyzon marinus let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gca   ug            u        ---------   -         
5'    ggg  agguaguagguu uguaguuc         ugc gggcagag 
      |||  |||||||||||| ||||||||         ||| ||||||| a
3'    ccc  uccgucaucuaa auaucaag         gcg cccguuuu 
   agg   gu            u        uagagguga   a         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-let-7b-5p

Accession MIMAT0019565
Previous IDspma-let-7b
Sequence

7 - 

ugagguaguagguuuuguaguu

 - 28

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-let-7b-3p

Accession MIMAT0019566
Previous IDspma-let-7b*
Sequence

66 - 

cuauauaaucuacugccuugccc

 - 88

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).