Stem-loop sequence pma-let-7c

AccessionMI0017149 (change log)
DescriptionPetromyzon marinus let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ccg          u   gu                uuagg   aca   uc 
5'    gcucgcgggg gag  aguagauuguaugguu     guc   ccc  g
      |||||||||| |||  ||||||||||||||||     |||   |||   
3'    ugggcgcccu uuc  ucaucuaacguaucaa     uag   ggg  g
   gcg          -   ug                -----   --a   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-let-7c

Accession MIMAT0019567
Sequence

14 - 

ugagguaguagauuguaugguu

 - 35

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).