Stem-loop sequence pma-let-7d

AccessionMI0017150 (change log)
DescriptionPetromyzon marinus let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ggugaggu                a      --------a      c u 
5'         gagguaguagguugua aguugu         gggugu a u
           |||||||||||||||| ||||||         |||||| | u
3'         uuccguuauccaacau ucaaua         cccaca u g
   -------c                g      gagguuuag      u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476357.1: 302830-302915 [-]
intergenic
Clustered miRNAs
< 10kb from pma-let-7d
pma-let-7a-3GL476357.1: 309640-309725 [-]
pma-let-7dGL476357.1: 302830-302915 [-]
Database links

Mature sequence pma-let-7d

Accession MIMAT0019568
Sequence

8 - 

ugagguaguagguuguaaaguu

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).