Stem-loop sequence cel-mir-4929

AccessionMI0017715 (change log)
DescriptionCaenorhabditis elegans miR-4929 stem-loop
Stem-loop
   uaaaauauuuu    c      -u       c         aaaa    ----c    ca 
5'            aauu auuaaa  aaauuug gcguaagau    ugca     ugca  c
              |||| ||||||  ||||||| |||||||||    ||||     ||||   
3'            uuaa uaauuu  uuuaaac cgcauucua    acgu     acgu  a
   -------acuu    u      cu       u         cacc    aacac    aa 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 13461755-13461864 [-]
sense
E01G4.3a ; E01G4.3a; intron 1
E01G4.3b.1 ; E01G4.3b.1; 5'UTR (exon 1)
E01G4.3b.2 ; E01G4.3b.2; intron 1
E01G4.3b.3 ; E01G4.3b.3; intron 1
E01G4.3c ; E01G4.3c; intron 3
Database links

Mature sequence cel-miR-4929

Accession MIMAT0020135
Sequence

67 - 

aaugcaccacaucuuacgcuca

 - 88

Get sequence
Deep sequencing61 reads, 11 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).