Stem-loop sequence cel-mir-4931

AccessionMI0017717 (change log)
DescriptionCaenorhabditis elegans miR-4931 stem-loop
Stem-loop
   gaauuuugcu   g              a a               gugcuccacc 
5'           cgc ccaaaaugagaacu c cgaccaaucagugau          c
             ||| |||||||||||||| | |||||||||||||||          a
3'           gug gguuuuacucuuga g guugguuagucgcua          a
   ---------g   -              c a               accaaguuau 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 2921186-2921290 [+]
antisense
Y71F9AL.18 ; Y71F9AL.18; intron 4
Database links

Mature sequence cel-miR-4931

Accession MIMAT0020137
Sequence

71 - 

ucgcugauugguugagcagu

 - 90

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).