Stem-loop sequence gma-MIR171g

Accession

MI0017841 (change log)

Description

Glycine max miR171g stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

15 open access papers mention gma-MIR171g
(36 sentences)

Stem-loop

   --------          u           a       uuu    aga 
5'         ugauguuggc uggcucaauca auuaaaa   uuaa   u
           |||||||||| ||||||||||| |||||||   ||||    
3'         acuauaaccg gccgaguuagu uaguuuu   aauu   u
   cuacuuau          u           c       uuc    guu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr16: 5376139-5376228 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017841

Mature sequence gma-miR171g

• Accession: MIMAT0020991
• Sequence: 61 - ugauugagccgugccaauauc - 81
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2. PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).