![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR398c |
|||||
Accession | MI0017847 (change log) | ||||
Description | Glycine max miR398c stem-loop | ||||
Gene family | MIPF0000107; MIR398 | ||||
Literature search |
![]()
17 open access papers mention gma-MIR398c | ||||
Stem-loop |
----u - u u u a -- -------- cc 5' ucua caggg cg ccugaga cacauga gu agaauau aagcag a |||| ||||| || ||||||| ||||||| || ||||||| |||||| 3' aggu guccc gc ggacucu guguacu cg ucuugug uucguu u uuauc c c u u - ac cucuguuc ua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR398c |
|
Accession | MIMAT0020997 |
Sequence |
80 - uguguucucaggucgccccug - 100 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|