Stem-loop sequence gma-MIR398c

AccessionMI0017847 (change log)
DescriptionGlycine max miR398c stem-loop
Gene family MIPF0000107; MIR398
Literature search

17 open access papers mention gma-MIR398c
(80 sentences)

Stem-loop 
   ----u    -     u  u       u       a  --       --------      cc 
5'      ucua caggg cg ccugaga cacauga gu  agaauau        aagcag  a
        |||| ||||| || ||||||| ||||||| ||  |||||||        ||||||   
3'      aggu guccc gc ggacucu guguacu cg  ucuugug        uucguu  u
   uuauc    c     c  u       u       -  ac       cucuguuc      ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 14229061-14229170 [-]
intergenic
Database links

Mature sequence gma-miR398c

Accession MIMAT0020997
Sequence

80 -  

uguguucucaggucgccccug

 - 100

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).