Stem-loop sequence gma-MIR2118b

AccessionMI0017850 (change log)
DescriptionGlycine max miR2118b stem-loop
Gene family MIPF0000403; MIR482
Literature search

14 open access papers mention gma-MIR2118b
(40 sentences)

Stem-loop 
   u        g       a    a   -           --u       u uc  uga 
5'  gaggaagu augggag uggg ggg ucgguaaagga   aacagcg c  ua   u
    |||||||| ||||||| |||| ||| |||||||||||   ||||||| |  ||    
3'  uucuuuua uauccuu accc ccu agccguuuucu   uuguugu g  gu   u
   -        g       -    a   u           uau       - uu  uaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 49169712-49169821 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR2118b
gma-MIR2118bchr10: 49169712-49169821 [-]
gma-MIR482dchr10: 49165318-49165412 [-]
Database links

Mature sequence gma-miR2118b-5p

Accession MIMAT0022982
Sequence

14 -  

ggagaugggagggucgguaaag

 - 35

Get sequence
Evidence experimental; Illumina [3-4]

Mature sequence gma-miR2118b-3p

Accession MIMAT0021000
Previous IDsgma-miR2118b
Sequence

79 -  

uugccgauuccacccauuccu

 - 99

Get sequence
Evidence experimental; 454 [1], Illumina [2-4]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
4
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).