![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR2118b |
||||||
Accession | MI0017850 (change log) | |||||
Description | Glycine max miR2118b stem-loop | |||||
Gene family | MIPF0000403; MIR482 | |||||
Literature search |
![]()
14 open access papers mention gma-MIR2118b | |||||
Stem-loop |
u g a a - --u u uc uga 5' gaggaagu augggag uggg ggg ucgguaaagga aacagcg c ua u |||||||| ||||||| |||| ||| ||||||||||| ||||||| | || 3' uucuuuua uauccuu accc ccu agccguuuucu uuguugu g gu u - g - a u uau - uu uaa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gma-miR2118b-5p |
|
Accession | MIMAT0022982 |
Sequence |
14 - ggagaugggagggucgguaaag - 35 |
Evidence | experimental; Illumina [3-4] |
Mature sequence gma-miR2118b-3p |
|
Accession | MIMAT0021000 |
Previous IDs | gma-miR2118b |
Sequence |
79 - uugccgauuccacccauuccu - 99 |
Evidence | experimental; 454 [1], Illumina [2-4] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
4 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|