miRBase entry: gma-MIR2118b

Stem-loop gma-MIR2118b


Accession
MI0017850
Description
Glycine max gma-MIR2118b precursor miRNA
Gene family
MIPF0000403; MIR482

Literature search
14 open access papers mention gma-MIR2118b
(42 sentences)

Sequence

ugaggaagugaugGGAGAUGGGAGGGUCGGUAAAGgauaacagcgucucuaugauuaauuguuguguuguuuauucuuUUGCCGAUUCCACCCAUUCCUaugauuuucuu
.((((((((.(((((((.((((.((((((((((((((.(((((((.(..((........))..))))))))...))))))))))).))).))))))))))).))))))))

Structure
u        g       A    A   -           --u       u uc  uga 
 gaggaagu augGGAG UGGG GGG UCGGUAAAGga   aacagcg c  ua   u
 |||||||| ||||||| |||| ||| |||||||||||   ||||||| |  ||    
 uucuuuua uaUCCUU ACCC CCU AGCCGUUuucu   uuguugu g  gu   u
-        g       -    A   U           uau       - uu  uaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 49169712-49169821 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from gma-MIR2118b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gma-miR2118b-3p

Accession MIMAT0021000
Description Glycine max gma-miR2118b-3p mature miRNA
Sequence 79 - UUGCCGAUUCCACCCAUUCCU - 99
Evidence experimental
454 [1], Illumina [2-4]

Mature gma-miR2118b-5p

Accession MIMAT0022982
Description Glycine max gma-miR2118b-5p mature miRNA
Sequence 14 - GGAGAUGGGAGGGUCGGUAAAG - 35
Evidence experimental
Illumina [3-4]

References

  1. PubMed ID: 21663675
    Identification of novel soybean microRNAs involved in abiotic and biotic stresses
    Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
    BMC Genomics (2011) 12:307

  2. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  3. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  4. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153