Stem-loop sequence gma-MIR1508c

AccessionMI0017855 (change log)
DescriptionGlycine max miR1508c stem-loop
Gene family MIPF0000719; MIR1508
Literature search

8 open access papers mention gma-MIR1508c
(18 sentences)

Stem-loop
   ----                             -c   uuacc ug    
5'     cuacucaacugcuauuuuccuuuuugaac  uug     u  agc 
       |||||||||||||||||||||||||||||  |||     |  || a
3'     gaugaguugacgauaaagggaaagauuug  aac     a  ucu 
   ucgu                             uu   ----u gu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 31140427-31140516 [+]
intergenic
Database links

Mature sequence gma-miR1508c

Accession MIMAT0021007
Sequence

61 - 

uagaaagggaaauagcaguug

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).