Stem-loop sequence bdi-MIR395a

AccessionMI0018081 (change log)
DescriptionBrachypodium distachyon miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395a
(36 sentences)

Stem-loop
   ca  a    ----aaug           a            u    u       guagcuagcuagcuagcuugugccucauuguuucauugc 
5'   gg gaug        guugguuguca cuggaguucucc caaa cacuuca                                       c
     || ||||        ||||||||||| |||||||||||| |||| |||||||                                       g
3'   cc cuau        caaccaacggu ggccucaagggg guuu gugaagu                                       c
   --  a    agucauaa           g            -    -       gacacgugccgagaggucgagguacgugugaauauuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 16374432-16374612 [+]
intergenic
Database links

Mature sequence bdi-miR395a

Accession MIMAT0020656
Sequence

132 - 

ugaaguguuugggggaacuc

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).