Stem-loop sequence bdi-MIR528

AccessionMI0018087 (change log)
DescriptionBrachypodium distachyon miR528 stem-loop
Gene family MIPF0000868; MIR528
Literature search

2 open access papers mention bdi-MIR528
(5 sentences)

Stem-loop
   -----uuugggguugggauuggg   u  -        cg            u   g     c  g  u  u      uu  a 
5'                        ggc gg agcagcag  guggaaggggca gca aggag ag ga ga gggggg  gu c
                          ||| || ||||||||  |||||||||||| ||| ||||| || || || ||||||  || u
3'                        ccg cc ucgucguc  uaccuucuccgu cgu uccuc uu cu cu cccuuc  cg c
   cgggucgggacggguggcucgug   -  a        cu            c   g     -  g  -  c      uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 73059536-73059695 [-]
intergenic
Database links

Mature sequence bdi-miR528-5p

Accession MIMAT0020662
Sequence

36 - 

uggaaggggcaugcagaggag

 - 56

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence bdi-miR528-3p

Accession MIMAT0027045
Sequence

102 - 

ccugugccugccucuuccauu

 - 122

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).