Stem-loop sequence bdi-MIR395b

AccessionMI0018088 (change log)
DescriptionBrachypodium distachyon miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395b
(31 sentences)

Stem-loop 
   ---------cggaccac       au     u         g             -a    caau 
5'                  guuuggu  uacca gaguucccu caagcacuucacg  ggcc    u
                    |||||||  ||||| ||||||||| |||||||||||||  ||||     
3'                  cgaacca  guggu cucaagggg guuugugaagugu  ucgg    a
   agaaaaauaaacacauu       cu     u         -             ca    uagu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55440558-55440678 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395b
bdi-MIR395o1: 55440734-55440819 [-]
bdi-MIR395b1: 55440558-55440678 [-]
bdi-MIR395m1: 55440156-55440250 [-]
Database links

Mature sequence bdi-miR395b

Accession MIMAT0020663
Sequence

70 -  

ugaaguguuugggggaacuc

 - 89

Get sequence
Evidence experimental; Illumina [1,3]

References

1
PMID:19772667 "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" Zhang J, Xu Y, Huan Q, Chong K BMC Genomics. 10:449(2009).
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).