![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR395b |
||||||||
Accession | MI0018088 (change log) | |||||||
Description | Brachypodium distachyon miR395b stem-loop | |||||||
Gene family | MIPF0000016; MIR395 | |||||||
Literature search |
![]()
3 open access papers mention bdi-MIR395b | |||||||
Stem-loop |
---------cggaccac au u g -a caau 5' guuuggu uacca gaguucccu caagcacuucacg ggcc u ||||||| ||||| ||||||||| ||||||||||||| |||| 3' cgaacca guggu cucaagggg guuugugaagugu ucgg a agaaaaauaaacacauu cu u - ca uagu |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bdi-miR395b |
|
Accession | MIMAT0020663 |
Sequence |
70 - ugaaguguuugggggaacuc - 89 |
Evidence | experimental; Illumina [1,3] |
References |
|
1 |
PMID:19772667
"Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"
BMC Genomics. 10:449(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|