Stem-loop sequence bdi-MIR168

AccessionMI0018098 (change log)
DescriptionBrachypodium distachyon miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

2 open access papers mention bdi-MIR168
(9 sentences)

Stem-loop
   -------ugcuccuccccugc   --     c   g gc             au     ccc    -    - c 
5'                      cgc  cgccg cuc g  ucgcuuggugcag  cggga   uccg cccg c c
                        |||  ||||| ||| |  |||||||||||||  |||||   |||| |||| |  
3'                      gcg  gcggc gag c  agugaaccacguu  gcccu   aggc gggc g c
   uccuuaauucauuuuuuuuca   ac     c   g ua             cc     ---    c    c c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 1774700-1774835 [-]
intergenic
Database links

Mature sequence bdi-miR168-5p

Accession MIMAT0020673
Sequence

31 - 

ucgcuuggugcagaucgggac

 - 51

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence bdi-miR168-3p

Accession MIMAT0027053
Sequence

79 - 

cccgccuugcaccaagugaau

 - 99

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).