Stem-loop sequence bdi-MIR164a

AccessionMI0018118 (change log)
DescriptionBrachypodium distachyon miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention bdi-MIR164a
(19 sentences)

Stem-loop
   ------gaguggacauaug         gc   a          c           auucguuccagcucgccgccggugugccgcgccgcggccugg 
5'                    aggcgaggc  gcg gguggagaag agggcacgugc                                          g
                      |||||||||  ||| |||||||||| |||||||||||                                          c
3'                    uccgcuccg  cgc ccaccucuuc ucccguguacg                                          g
   ccgcacgcgcgcgcaagcg         aa   g          u           uacgugugugugcgcguaccggccggcgagcccgcugugcgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 19949322-19949514 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR164a
bdi-MIR164f2: 19949341-19949501 [+]
bdi-MIR164a2: 19949322-19949514 [-]
Database links

Mature sequence bdi-miR164a-5p

Accession MIMAT0020693
Sequence

31 - 

uggagaagcagggcacgugca

 - 51

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence bdi-miR164a-3p

Accession MIMAT0027067
Sequence

139 - 

caugugcccuucuucuccacc

 - 159

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).