![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR164a |
||||||
Accession | MI0018118 (change log) | |||||
Description | Brachypodium distachyon miR164a stem-loop | |||||
Gene family | MIPF0000045; MIR164 | |||||
Literature search |
![]()
4 open access papers mention bdi-MIR164a | |||||
Stem-loop |
------gaguggacauaug gc a c auucguuccagcucgccgccggugugccgcgccgcggccugg 5' aggcgaggc gcg gguggagaag agggcacgugc g ||||||||| ||| |||||||||| ||||||||||| c 3' uccgcuccg cgc ccaccucuuc ucccguguacg g ccgcacgcgcgcgcaagcg aa g u uacgugugugugcgcguaccggccggcgagcccgcugugcgc |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bdi-miR164a-5p |
|
Accession | MIMAT0020693 |
Sequence |
31 - uggagaagcagggcacgugca - 51 |
Evidence | experimental; Illumina [1,3] |
Mature sequence bdi-miR164a-3p |
|
Accession | MIMAT0027067 |
Sequence |
139 - caugugcccuucuucuccacc - 159 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:19772667
"Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"
BMC Genomics. 10:449(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|