![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR827 |
|||||
Accession | MI0018128 (change log) | ||||
Description | Brachypodium distachyon miR827 stem-loop | ||||
Gene family | MIPF0000726; MIR827 | ||||
Literature search |
2 open access papers mention bdi-MIR827 | ||||
Stem-loop |
auug - -- u - --g - u u u a uccgugcuucggugcuugu 5' agc c gau caug ca cuc ugaac uguuu guuggu gucaucuaaccaucg ucgg g ||| | ||| |||| || ||| ||||| ||||| |||||| ||||||||||||||| |||| c 3' ucg g cug gugc gu gag gcuug acaaa cgacua caguagauugguagc ggcc c ---- a uc c c aca u u - c - acacuacuacguuuuagua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR827-5p |
|
Accession | MIMAT0027075 |
Sequence |
31 - uuuuguugguugucaucuaacc - 52 |
Evidence | experimental; Illumina [3] |
Mature sequence bdi-miR827-3p |
|
Accession | MIMAT0020703 |
Sequence |
113 - uuagaugaccaucagcaaaca - 133 |
Evidence | experimental; Illumina [1,3] |
References |
|
1 |
PMID:19772667
"Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"
BMC Genomics. 10:449(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|