Stem-loop sequence bdi-MIR827

AccessionMI0018128 (change log)
DescriptionBrachypodium distachyon miR827 stem-loop
Gene family MIPF0000726; MIR827
Literature search

2 open access papers mention bdi-MIR827
(2 sentences)

Stem-loop 
   auug   - --   u    -  --g   -     u     u      u               a    uccgugcuucggugcuugu 
5'     agc c  gau caug ca   cuc ugaac uguuu guuggu gucaucuaaccaucg ucgg                   g
       ||| |  ||| |||| ||   ||| ||||| ||||| |||||| ||||||||||||||| ||||                   c
3'     ucg g  cug gugc gu   gag gcuug acaaa cgacua caguagauugguagc ggcc                   c
   ----   a uc   c    c  aca   u     u     -      c               -    acacuacuacguuuuagua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 18037481-18037644 [-]
intergenic
Database links

Mature sequence bdi-miR827-5p

Accession MIMAT0027075
Sequence

31 -  

uuuuguugguugucaucuaacc

 - 52

Get sequence
Evidence experimental; Illumina [3]

Mature sequence bdi-miR827-3p

Accession MIMAT0020703
Sequence

113 -  

uuagaugaccaucagcaaaca

 - 133

Get sequence
Evidence experimental; Illumina [1,3]

References

1
PMID:19772667 "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" Zhang J, Xu Y, Huan Q, Chong K BMC Genomics. 10:449(2009).
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).