Stem-loop sequence bdi-MIR5163a

AccessionMI0018129 (change log)
DescriptionBrachypodium distachyon miR5163a stem-loop
Gene family MIPF0001817; MIR5163
Stem-loop
   ----c    gcuc uc            u c     uc            ---   g          a            a        --     ua 
5'      agag    g  gauugcaaauca g gugca  uuucuauuauug   agc uaccuagccu aaauauuuaaaa uaauugga  gcaac  a
        ||||    |  |||||||||||| | |||||  ||||||||||||   ||| |||||||||| |||||||||||| ||||||||  |||||  a
3'      uuuc    c  uuagcguuuagu c cacgu  gaaggugguaac   ucg guggauugga uuuauggauuuu auuaacuu  uguug  g
   uagga    --aa ua            c a     -u            caa   -          c            c        gu     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 11947824-11948009 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR5163a
bdi-MIR5163b4: 11948702-11948890 [-]
bdi-MIR5163a4: 11947824-11948009 [-]
Database links

Mature sequence bdi-miR5163a-5p

Accession MIMAT0027076
Sequence

53 - 

ccuagccuaaaauauuuaaaa

 - 73

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5163a-3p

Accession MIMAT0020704
Sequence

113 - 

uuagguauuucagguuaggug

 - 133

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).