Stem-loop sequence bdi-MIR5165

AccessionMI0018132 (change log)
DescriptionBrachypodium distachyon miR5165 stem-loop
Stem-loop
   ------------       -gg   -aga                u          g     u         ca             ugaau             c c         c    u         a 
5'             uagcuuu   ggc    guuaccaugaauuccc gccauaucuu ggcuc agguagguu  auccucaauugaa     cgaaggaauuaaa c agcagcaaa aaac gaaauuacc a
               |||||||   |||    |||||||||||||||| |||||||||| ||||| |||||||||  |||||||||||||     ||||||||||||| | ||||||||| |||| ||||||||| a
3'             guugaaa   ucg    caaugguacuuaaggg ugguauagaa ccgag uccauccaa  uaggaguuaacuu     gcuuccuuaauuu g ucgucguuu uuug cuuuaaugg u
   ucauuuaucagg       aca   agac                -          a     u         ua             ----u             a c         -    u         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 33186148-33186396 [-]
intergenic
Database links

Mature sequence bdi-miR5165-5p

Accession MIMAT0020707
Sequence

38 - 

aucuugggcucuagguagguu

 - 58

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence bdi-miR5165-3p

Accession MIMAT0027077
Sequence

181 - 

ccuaccuugagccaaagauau

 - 201

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).