Stem-loop sequence bdi-MIR395m

AccessionMI0018219 (change log)
DescriptionBrachypodium distachyon miR395m stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395m
(31 sentences)

Stem-loop
   u   au     u         ug             uacg  g a  au 
5'  ggu  uacca gaguuccuu  caagcauuucacg    ag c cu  c
    |||  ||||| |||||||||  |||||||||||||    || | ||   
3'  cca  guggu cucaagggg  guuugugaagugu    uc g ga  c
   a   cu     u         --             --ua  g -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55440156-55440250 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395m
bdi-MIR395o1: 55440734-55440819 [-]
bdi-MIR395b1: 55440558-55440678 [-]
bdi-MIR395m1: 55440156-55440250 [-]
Database links

Mature sequence bdi-miR395m

Accession MIMAT0020744
Sequence

64 - 

ugaaguguuugggggaacuc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1