Stem-loop sequence bdi-MIR395f

AccessionMI0018221 (change log)
DescriptionBrachypodium distachyon miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395f
(33 sentences)

Stem-loop
           u c             u               gca   u 
5' guuuggug c ccgggaguucccu caaacacuuuacgaa   ucu u
   |||||||| | ||||||||||||| |||||||||||||||   ||| c
3' cgaaccac g ggcucucaagggg guuugugaaguguuu   aga u
           u u             -               auc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25455426-25455521 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395f
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395f-5p

Accession MIMAT0027090
Sequence

18 - 

guucccuucaaacacuuuacg

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395f-3p

Accession MIMAT0020746
Sequence

62 - 

ugaaguguuugggggaacuc

 - 81

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).