Stem-loop sequence bdi-MIR395g

AccessionMI0018222 (change log)
DescriptionBrachypodium distachyon miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395g
(31 sentences)

Stem-loop
       u  c            g              gu      u 
5' ggug ua caggaguuuccu caaacacuucacga  gccuau u
   |||| || |||||||||||| ||||||||||||||  ||||||  
3' ccac gu guucucaagggg guuugugaaguguu  ugggua u
       u  a            -              gu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25455723-25455811 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395g
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395g-5p

Accession MIMAT0027091
Sequence

14 - 

guuuccugcaaacacuucacg

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395g-3p

Accession MIMAT0020747
Sequence

59 - 

ugaaguguuugggggaacuc

 - 78

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).