Stem-loop sequence bdi-MIR395h

AccessionMI0018223 (change log)
DescriptionBrachypodium distachyon miR395h stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395h
(31 sentences)

Stem-loop
       u         g             -a    g  u 
5' acca gaguucccu caagcacuucacg  ggcc uu u
   |||| ||||||||| |||||||||||||  |||| ||  
3' uggu cucaagggg guuugugaagugu  ucgg ag c
       u         -             ca    g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25455882-25455957 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395h
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395h-5p

Accession MIMAT0027092
Sequence

8 - 

guucccugcaagcacuucacg

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395h-3p

Accession MIMAT0020748
Sequence

52 - 

ugaaguguuugggggaacuc

 - 71

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).