Stem-loop sequence bdi-MIR395j

AccessionMI0018224 (change log)
DescriptionBrachypodium distachyon miR395j stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395j
(32 sentences)

Stem-loop
      auuc   u         g             -a    g  u 
5' ggu    uca gaguuuccc caagcacuucacg  ggcc uu u
   |||    ||| ||||||||| |||||||||||||  |||| ||  
3' cca    ggu cucaagggg guuugugaagugu  ucgg ag c
      cucu   u         -             ca    g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25456151-25456238 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395j
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395j-5p

Accession MIMAT0027093
Sequence

14 - 

guuucccgcaagcacuucacg

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395j-3p

Accession MIMAT0020749
Sequence

58 - 

ugaaguguuugggggaacuc

 - 77

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).