Stem-loop sequence bdi-MIR395k

AccessionMI0018225 (change log)
DescriptionBrachypodium distachyon miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395k
(32 sentences)

Stem-loop
      c     u         g            - a     aau 
5' gua uacca gaguucccu caagcacuucau g ggccc   u
   ||| ||||| ||||||||| |||||||||||| | |||||    
3' cau guggu cucaagggg guuugugaagug c ucggg   c
      u     u         -            u a     agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25456290-25456375 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395k
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395k-5p

Accession MIMAT0027094
Sequence

13 - 

guucccugcaagcacuucaug

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395k-3p

Accession MIMAT0020750
Sequence

57 - 

ugaaguguuugggggaacuc

 - 76

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).