Stem-loop sequence bdi-MIR395l

AccessionMI0018226 (change log)
DescriptionBrachypodium distachyon miR395l stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395l
(31 sentences)

Stem-loop
          au     u         g             -a   a  au 
5' guuuggu  uauca gaguucccu caagcacuucacg  ggc cu  c
   |||||||  ||||| ||||||||| |||||||||||||  ||| ||   
3' cgaacca  guggu cucaagggg guuugugaagugu  ucg ga  c
          cu     u         -             ca   g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25456562-25456657 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395l
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395l-5p

Accession MIMAT0027095
Sequence

18 - 

guucccugcaagcacuucacg

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395l-3p

Accession MIMAT0020751
Sequence

62 - 

ugaaguguuugggggaacuc

 - 81

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).