Stem-loop sequence bdi-MIR5201

AccessionMI0018233 (change log)
DescriptionBrachypodium distachyon miR5201 stem-loop
Stem-loop
       c            c         g        c    ucc 
5' cacu ugaucauuugcc cgucuugua cacugaca gugg   a
   |||| |||||||||||| ||||||||| |||||||| ||||    
3' guga acuaguaaacgg gcgggacau gugacugu cacc   u
       a            a         a        a    ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 42461428-42461517 [-]
intergenic
Database links

Mature sequence bdi-miR5201-5p

Accession MIMAT0027098
Sequence

6 - 

ugaucauuugccccgucuugu

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5201-3p

Accession MIMAT0020758
Sequence

67 - 

agggcgaggcaaaugaucaaa

 - 87

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).