Stem-loop sequence bdi-MIR319b

AccessionMI0018236 (change log)
DescriptionBrachypodium distachyon miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

1 open access papers mention bdi-MIR319b
(2 sentences)

Stem-loop
   --a    --    a    u            cu u    ug  ugu        -au     g   au       u  ac         au    agg 
5'    ugua  uaag gagc cucuucagucca  c caga  ac   aggguuuu   uagcu ccg  ucaucca uc  cuaccaaga  caug   g
      ||||  |||| |||| ||||||||||||  | ||||  ||   ||||||||   ||||| |||  ||||||| ||  |||||||||  ||||    
3'    acau  guuc cucg gggaagucaggu  g guuu  ug   uuucgaaa   aucga ggc  gguaggu ag  gaugguucu  guau   c
   aua    uc    c    u            ug u    gu  -cu        aac     g   ac       c  cc         --    aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 45992390-45992579 [-]
intergenic
Database links

Mature sequence bdi-miR319b-5p

Accession MIMAT0027099
Sequence

10 - 

agagcucucuucaguccacuc

 - 30

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR319b-3p

Accession MIMAT0020761
Sequence

159 - 

uuggacugaagggugcucccu

 - 179

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).