Stem-loop sequence mtr-MIR5212

AccessionMI0018252 (change log)
DescriptionMedicago truncatula miR5212 stem-loop
Stem-loop
   --u      a       u  g              -ga       
5'    gguagc guuggau uc uauuucuuugguag   uguugg 
      |||||| ||||||| || ||||||||||||||   ||||| g
3'    ucaucg cgaccua ag auaaaggaaccauc   acaacc 
   cug      c       u  -              aua       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 11616948-11617032 [-]
intergenic
Database links

Mature sequence mtr-miR5212-5p

Accession MIMAT0021145
Sequence

11 - 

uggauuucguauuucuuuggua

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR5212-3p

Accession MIMAT0027100
Sequence

55 - 

ccaaggaaauagauauccagc

 - 75

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).