![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR5213 |
|||||
Accession | MI0018253 (change log) | ||||
Description | Medicago truncatula miR5213 stem-loop | ||||
Literature search |
1 open access papers mention mtr-MIR5213 | ||||
Stem-loop |
u -uu a u c cuau uauu uu a 5' uag gaaa gau cgugugucu cac ucugaa caa aug uc aaucu ||| |||| ||| ||||||||| ||| |||||| ||| ||| || |||| u 3' auc cuuu cua gcacauaga gug agacuu guu uac ag uuagu - ucu c c - ---c uucu uu c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mtr-miR5213-5p |
|
Accession | MIMAT0021146 |
Previous IDs | mtr-miR5213 |
Sequence |
13 - uacgugugucuucaccucugaa - 34 |
Evidence | experimental; Illumina [1-3] |
Mature sequence mtr-miR5213-3p |
|
Accession | MIMAT0021147 |
Previous IDs | mtr-miR5213* |
Sequence |
83 - cagagugcagauacacgcauc - 103 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:21762498
"Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing"
BMC Genomics. 12:367(2011).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|