Stem-loop sequence mtr-MIR5213

AccessionMI0018253 (change log)
DescriptionMedicago truncatula miR5213 stem-loop
Literature search

1 open access papers mention mtr-MIR5213
(2 sentences)

Stem-loop 
      u    -uu   a         u   c      cuau   uauu   uu  a      
5' uag gaaa   gau cgugugucu cac ucugaa    caa    aug  uc aaucu 
   ||| ||||   ||| ||||||||| ||| ||||||    |||    |||  || |||| u
3' auc cuuu   cua gcacauaga gug agacuu    guu    uac  ag uuagu 
      -    ucu   c         c   -      ---c   uucu   uu  c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 18000286-18000398 [+]
intergenic
Database links

Mature sequence mtr-miR5213-5p

Accession MIMAT0021146
Previous IDsmtr-miR5213
Sequence

13 -  

uacgugugucuucaccucugaa

 - 34

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence mtr-miR5213-3p

Accession MIMAT0021147
Previous IDsmtr-miR5213*
Sequence

83 -  

cagagugcagauacacgcauc

 - 103

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:21762498 "Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing" Wang T, Chen L, Zhao M, Tian Q, Zhang WH BMC Genomics. 12:367(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).