Stem-loop sequence mtr-MIR5214

AccessionMI0018254 (change log)
DescriptionMedicago truncatula miR5214 stem-loop
Stem-loop
   uccc     u     -ua                        uc   gu 
5'     gucuu cuccg   gucuagcucuauuaacaauuaaau  acc  u
       ||||| |||||   ||||||||||||||||||||||||  |||   
3'     cagag gaggc   cagaucgagauaguuguuaauuua  ugg  g
   uucc     c     uac                        ga   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 1385082-1385180 [-]
intergenic
Database links

Mature sequence mtr-miR5214-5p

Accession MIMAT0027101
Sequence

21 - 

uagcucuauuaacaauuaaau

 - 41

Get sequence
Evidence experimental; Illumina [3]

Mature sequence mtr-miR5214-3p

Accession MIMAT0021148
Sequence

68 - 

ugauagagcuagaccaucggag

 - 89

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).