Stem-loop sequence mtr-MIR172b

AccessionMI0018368 (change log)
DescriptionMedicago truncatula miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

7 open access papers mention mtr-MIR172b
(30 sentences)

Stem-loop
   uguuu  a                     auaugugaaugaugcagaguggaacug 
5'      gc gauguagcaucaucaagauuc                           c
        || |||||||||||||||||||||                            
3'      cg cuacgucguaguaguucuaag                           u
   uauac  a                     aauaaaguuuucuaguuaacuuuauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC235487.1: 197953-198066 [+]
intergenic
Database links

Mature sequence mtr-miR172b

Accession MIMAT0021264
Sequence

85 - 

agaaucuugaugaugcugcau

 - 105

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).