Stem-loop sequence mtr-MIR172c

AccessionMI0018369 (change log)
DescriptionMedicago truncatula miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

7 open access papers mention mtr-MIR172c
(33 sentences)

Stem-loop
   uauuu  a                     a  -ua      u  aa    uuuug        ug   u 
5'      gc gauguagcaucaucaagauuc ca   ugaaag gc  augg     uuggauuu  auc g
        || ||||||||||||||||||||| ||   |||||| ||  ||||     ||||||||  ||| a
3'      cg cuacgucguaguaguucuaag gu   guuuuc ug  uacc     aaucuaaa  uag u
   aauac  a                     a  caa      -  ga    ucuug        cg   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC233663.2: 10169-10307 [+]
intergenic
Database links

Mature sequence mtr-miR172c-5p

Accession MIMAT0021265
Previous IDsmtr-miR172c*
Sequence

12 - 

guagcaucaucaagauucaca

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR172c-3p

Accession MIMAT0021266
Previous IDsmtr-miR172c
Sequence

110 - 

agaaucuugaugaugcugcau

 - 130

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).