Stem-loop sequence mtr-MIR171h

AccessionMI0018372 (change log)
DescriptionMedicago truncatula miR171h stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

9 open access papers mention mtr-MIR171h
(198 sentences)

Stem-loop
   aa  ag  a            u   u    a      uaaauaa   au     a 
5'   gu  ac ggagugguguug uuc gcuc ucuuau       uga  gaaug a
     ||  || |||||||||||| ||| |||| ||||||       |||  ||||| u
3'   ca  ug ccucacuauaac aag cgag agaaua       auu  uuuac g
   uc  ca  a            u   c    c      ----uuc   cg     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 31404708-31404816 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR171h
mtr-MIR171gchr3: 31404873-31405008 [-]
mtr-MIR171hchr3: 31404708-31404816 [-]
Database links

Mature sequence mtr-miR171h

Accession MIMAT0021269
Sequence

79 - 

cgagccgaaucaauaucacuc

 - 99

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).