![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR168b |
|||||
Accession | MI0018373 (change log) | ||||
Description | Medicago truncatula miR168b stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
![]()
5 open access papers mention mtr-MIR168b | ||||
Stem-loop |
---aa c u a uuacau acagu 5' ccucugauucg uuggugcagg cggga cca cc u ||||||||||| |||||||||| ||||| ||| || 3' ggaggcuaagc aacuacguuc guccu ggu gg u acguc u c a -uaaau cuccc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mtr-miR168b |
|
Accession | MIMAT0021270 |
Sequence |
11 - ucgcuuggugcaggucgggaa - 31 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|