Stem-loop sequence mtr-MIR168b

AccessionMI0018373 (change log)
DescriptionMedicago truncatula miR168b stem-loop
Gene family MIPF0000081; MIR168
Literature search

5 open access papers mention mtr-MIR168b
(20 sentences)

Stem-loop
   ---aa           c          u     a   uuacau  acagu 
5'      ccucugauucg uuggugcagg cggga cca      cc     u
        ||||||||||| |||||||||| ||||| |||      ||      
3'      ggaggcuaagc aacuacguuc guccu ggu      gg     u
   acguc           u          c     a   -uaaau  cuccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 41975236-41975333 [+]
intergenic
Database links

Mature sequence mtr-miR168b

Accession MIMAT0021270
Sequence

11 - 

ucgcuuggugcaggucgggaa

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).