Stem-loop sequence mtr-MIR156j

AccessionMI0018375 (change log)
DescriptionMedicago truncatula miR156j stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156j
(77 sentences)

Stem-loop
   a   -a       a        gg        a     gucuuua     ua 
5'  cau  gaaauug cagaagag  ugagcaca aaaaa       guaua  a
    |||  ||||||| ||||||||  |||||||| |||||       |||||  u
3'  gua  uuuuaac gucuucuc  acucgugu uuuuu       cauau  g
   -   ac       a        au        g     --auuac     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 3468974-3469076 [+]
intergenic
Database links

Mature sequence mtr-miR156j

Accession MIMAT0021272
Sequence

11 - 

ugacagaagagggugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).