Stem-loop sequence rmi-mir-5316a

AccessionMI0018496 (change log)
DescriptionRhipicephalus microplus miR-5316a stem-loop
Gene family MIPF0001364; mir-5316
Stem-loop
   ---   uuugu     uagc     g -      u  u     u  auu    g 
5'    gau     accac    aggcu g cgaaaa gu ccggu ga   gaau g
      |||     |||||    ||||| | |||||| || ||||| ||   |||| c
3'    cug     uggug    uucga c gcuuuu cg ggcca cu   uuua u
   aca   cucuu     -ccu     g a      u  c     -  --g    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5316a

Accession MIMAT0021387
Sequence

60 - 

ucaccggcgcuuuuucgacgag

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).