Stem-loop sequence gma-MIR5037c

AccessionMI0018625 (change log)
DescriptionGlycine max miR5037c stem-loop
Gene family MIPF0001288; MIR5037
Literature search

2 open access papers mention gma-MIR5037c
(2 sentences)

Stem-loop
           ac        gcu           auauuucagucuagug 
5' cuuuagca  ccucaaag   uccacuacucc                a
   ||||||||  ||||||||   |||||||||||                 
3' gaagucgu  ggaguuuc   aggugaugagg                a
           cc        --a           agguacaaacaccugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 47698518-47698613 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5037c
gma-MIR5037cchr8: 47698518-47698613 [+]
gma-MIR862bchr8: 47704165-47704250 [+]
Database links

Mature sequence gma-miR5037c

Accession MIMAT0021606
Sequence

72 - 

aguggaacuuugaggccugc

 - 91

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).