Stem-loop gma-MIR5374

Accession

MI0018633

Description

Glycine max gma-MIR5374 precursor miRNA

Literature search

2 open access papers mention gma-MIR5374
(2 sentences)

Sequence

caucgagauuUUAUAGUCUGACAUCUGGAAUuuaaaugucucaacaagggcguuagauccaacaacguuccacaaugcuaaugggagaauucaaauuugggaccucucucucauuucuucuccuuucacgcuuugaaacaaauaaaggacacccgagauccccguagaagcucuuguuggaaaauuuagauUUCAAAUGUCAGAUUAUAAAAcaugggug
((((.(..((((((((((((((((.((((((((((((.((.((((((((((.((((((((......(((...(((.((....(((((((...((((..((((....))))..)))).))))))).....)).))).))).......((....))).))))....)))..))))))))))))..)))))))))))).))))))))))))))))..).))))

Structure

    g ga                C            -g  u          -g   ----    - ---------aacaac   cca   u  -uaau       uuc    uu    c 
cauc a  uuUUAUAGUCUGACAU UGGAAUuuaaau  uc caacaagggc  uua    gauc c               guu   caa gc     gggagaa   aaau  ggga c
|||| |  |||||||||||||||| ||||||||||||  || ||||||||||  |||    |||| |               |||   ||| ||     |||||||   ||||  ||||  
gugg u  AAAAUAUUAGACUGUA ACUUuagauuua  ag guuguucucg  gau    cuag g               caa   guu cg     uccucuu   uuua  cucu u
    g ac                A            aa  -          aa   gccc    a cccacaggaaauaaa   --a   u  cacuu       --c    cu    c 

Annotation confidence Not enough data

Genome context

chr5: 12748029-12748248 [-]

Mature gma-miR5374-5p

• Accession: MIMAT0021615
• Description: Glycine max gma-miR5374-5p mature miRNA
• Sequence: 11 - UUAUAGUCUGACAUCUGGAAU - 31
• Evidence: experimental ; Illumina [1-2]

Mature gma-miR5374-3p

• Accession: MIMAT0032125
• Description: Glycine max gma-miR5374-3p mature miRNA
• Sequence: 192 - UUCAAAUGUCAGAUUAUAAAA - 212
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


3. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153