Stem-loop sequence gma-MIR5374

AccessionMI0018633 (change log)
DescriptionGlycine max miR5374 stem-loop
Literature search

2 open access papers mention gma-MIR5374
(2 sentences)

Stem-loop
       g ga                c            g cu          -----guua    caacaacguuccacaaugcuaaugggagaauucaaauuugggaccuc 
5' cauc a  uuuuauagucugacau uggaauuuaaau u  caacaagggc         gauc                                               u
   |||| |  |||||||||||||||| |||||||||||| |  ||||||||||         ||||                                               c
3' gugg u  aaaauauuagacugua acuuuagauuua a  guuguucucg         cuag                                               u
       g ac                a            a ag          aagaugccc    agcccacaggaaauaaacaaaguuucgcacuuuccucuucuuuacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 12748029-12748248 [-]
intergenic
Database links

Mature sequence gma-miR5374-5p

Accession MIMAT0021615
Previous IDsgma-miR5374
Sequence

11 - 

uuauagucugacaucuggaau

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence gma-miR5374-3p

Accession MIMAT0032125
Sequence

192 - 

uucaaaugucagauuauaaaa

 - 212

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3