![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171j |
|||||
Accession | MI0018641 (change log) | ||||
Description | Glycine max miR171j stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
15 open access papers mention gma-MIR171j | ||||
Stem-loop |
u u c c auguau - -gu cc --c a 5' augaaguagu auug gauauuggc ugguuca ucagac accacgg cacg ugugu uug uaga a |||||||||| |||| ||||||||| ||||||| |||||| ||||||| |||| ||||| ||| |||| 3' uacuuuaucg ugac cuauaaccg gccgagu aguuug ugguguu gugu acaua aac auuu g - u u u -gguuu a ugu -a aaa a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171j-5p |
|
Accession | MIMAT0021623 |
Previous IDs | gma-miR171j |
Sequence |
19 - uauuggccugguucacucaga - 39 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR171j-3p |
|
Accession | MIMAT0022990 |
Sequence |
118 - ugauugagccgugccaauauc - 138 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|