![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR397a |
|||||
Accession | MI0018645 (change log) | ||||
Description | Glycine max miR397a stem-loop | ||||
Gene family | MIPF0000120; MIR397 | ||||
Literature search |
![]()
15 open access papers mention gma-MIR397a | ||||
Stem-loop |
c c - uu --------cu c 5' agagaaacau auugagugcag guugauga agu cacu caucu a |||||||||| ||||||||||| |||||||| ||| |||| ||||| g 3' ucuuuuugua uaacucacguc cagcuacu uua guga guaga g c a g uu uauuuaauuc u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR397a |
|
Accession | MIMAT0021627 |
Sequence |
10 - ucauugagugcagcguugaug - 30 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|