Stem-loop sequence gma-MIR397a

AccessionMI0018645 (change log)
DescriptionGlycine max miR397a stem-loop
Gene family MIPF0000120; MIR397
Literature search

15 open access papers mention gma-MIR397a
(66 sentences)

Stem-loop 
             c           c        -   uu    --------cu     c 
5' agagaaacau auugagugcag guugauga agu  cacu          caucu a
   |||||||||| ||||||||||| |||||||| |||  ||||          ||||| g
3' ucuuuuugua uaacucacguc cagcuacu uua  guga          guaga g
             c           a        g   uu    uauuuaauuc     u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 4644313-4644420 [-]
intergenic
Database links

Mature sequence gma-miR397a

Accession MIMAT0021627
Sequence

10 -  

ucauugagugcagcguugaug

 - 30

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).