![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR162c |
|||||
Accession | MI0018659 (change log) | ||||
Description | Glycine max miR162c stem-loop | ||||
Gene family | MIPF0000127; MIR162_1 | ||||
Literature search |
![]()
10 open access papers mention gma-MIR162c | ||||
Stem-loop |
gagau ug --- a g c c uc c aauuugg ga 5' gagg aagu c cugga gcag gguu aucgauc uuc ug uugug a |||| |||| | ||||| |||| |||| ||||||| ||| || ||||| 3' cucc uuca g gaccu cguc ccaa uagcugg aag ac aacac g ----- gu cuc c a u a cu a -----ga aa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR162c |
|
Accession | MIMAT0021644 |
Sequence |
84 - ucgauaaaccucugcauccag - 104 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|