miRBase entry: gma-MIR319h

Stem-loop gma-MIR319h


Accession
MI0018673
Description
Glycine max gma-MIR319h precursor miRNA
Gene family
MIPF0000010; MIR159

Literature search
17 open access papers mention gma-MIR319h
(42 sentences)

Sequence

aguugaagagagcuuccuucaguccacucauggaugggaaagggguuugaauuagcugcugacucauucauucaaacacaauagauucggcuucaugauauguuauugugaaugugugaaugaugcgggagguaaauuucuuccuuuucuuguccuugcUUGGACUGAAGGGAGCUCCCUcuaacu
(((((.((.(((((((((((((((((..((.((((((((((((((...((.(((.((.(((..((((((((.((..((((((((..(((......)))....))))))))..)).))))))))..))).)).))).))...)))))))))))))).))..))))))))))))))))).)).)))))

Structure
     a  a                 cu  u              uuu  a   g  g   ac        u  aa        --au   gc 
aguug ag gagcuuccuucagucca  ca ggaugggaaagggg   ga uua cu cug  ucauucau ca  cacaauag    ucg  u
||||| || |||||||||||||||||  || ||||||||||||||   || ||| || |||  |||||||| ||  ||||||||    |||   
ucaau UC CUCGAGGGAAGUCAGGU  gu ccuguucuuuuccu   uu aau ga ggc  aguaagug gu  guguuauu    agu  u
     c  C                 Uc  u              ucu  a   g  g   gu        u  aa        guau   ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 42629369-42629554 [+]

Database links

Mature gma-miR319h

Accession MIMAT0021662
Description Glycine max gma-miR319h mature miRNA
Sequence 160 - UUGGACUGAAGGGAGCUCCCU - 180
Evidence experimental
Illumina [1-3]

References

  1. PubMed ID: 21663675
    Identification of novel soybean microRNAs involved in abiotic and biotic stresses
    Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
    BMC Genomics (2011) 12:307

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  3. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153