Stem-loop sequence gma-MIR319h

AccessionMI0018673 (change log)
DescriptionGlycine max miR319h stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319h
(42 sentences)

Stem-loop
        a  a                 cu  u   ug         uuu  a   g  g   ac        u  aa        --au   gc 
5' aguug ag gagcuuccuucagucca  ca gga  ggaaagggg   ga uua cu cug  ucauucau ca  cacaauag    ucg  u
   ||||| || |||||||||||||||||  || |||  |||||||||   || ||| || |||  |||||||| ||  ||||||||    |||   
3' ucaau uc cucgagggaagucaggu  gu ccu  ucuuuuccu   uu aau ga ggc  aguaagug gu  guguuauu    agu  u
        c  c                 uc  u   gu         ucu  a   g  g   gu        u  aa        guau   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 42629369-42629554 [+]
intergenic
Database links

Mature sequence gma-miR319h

Accession MIMAT0021662
Sequence

160 - 

uuggacugaagggagcucccu

 - 180

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3