Stem-loop sequence gma-MIR319j

AccessionMI0018675 (change log)
DescriptionGlycine max miR319j stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319j
(42 sentences)

Stem-loop
      u   a             c   cuc     u    a            a -  g   ac        a  ca        ga    a 
5' agg aag gagcucucuucag cca   auagg gaua uaggauuuaauu g cu ccg  ucauucau ca  ugcugagu  auua u
   ||| ||| ||||||||||||| |||   ||||| |||| |||||||||||| | || |||  |||||||| ||  ||||||||  |||| g
3' ucu uuc cucgagggaaguc ggu   ugucu uugu auucuaaguuaa c ga ggc  aguaagug gu  augacuca  uaau a
      u   c             a   uca     u    -            a a  g   au        a  aa        --    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 1382971-1383149 [+]
intergenic
Database links

Mature sequence gma-miR319j

Accession MIMAT0021664
Sequence

154 - 

uuggacugaagggagcucccu

 - 174

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).