Stem-loop sequence gma-MIR1512b

AccessionMI0018682 (change log)
DescriptionGlycine max miR1512b stem-loop
Gene family MIPF0001291; MIR1512
Literature search

12 open access papers mention gma-MIR1512b
(28 sentences)

Stem-loop
   u    a c      g                  ---------      c 
5'  ugau c uaacug aaauucuuaaagcauucc         caucau a
    |||| | |||||| ||||||||||||||||||         ||||||  
3'  acua g auugac uuuaagaauuucguaagg         guagua a
   -    c u      -                  auuaaaagu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 8707970-8708058 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1512b
gma-MIR1512bchr2: 8707970-8708058 [-]
gma-MIR1512cchr2: 8698923-8699026 [-]
Database links

Mature sequence gma-miR1512b

Accession MIMAT0021673
Sequence

9 - 

uaacuggaaauucuuaaagcau

 - 30

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).