Stem-loop sequence gma-MIR4415b

AccessionMI0018685 (change log)
DescriptionGlycine max miR4415b stem-loop
Gene family MIPF0001314; MIR4415
Literature search

1 open access papers mention gma-MIR4415b
(4 sentences)

Stem-loop
        c    a                       caaucacgccaagaaaaugaaaucccauuaucuucucacagua 
5' ggcug auca guugugaugggaaucaauggcag                                           u
   ||||| |||| |||||||||||||||||||||||                                            
3' cugac uggu caacacuacucuuaguuaccguc                                           a
        c    a                       auuaccuaaauauaggcaguuguggucaaucggauuaauuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 23061554-23061709 [+]
intergenic
Database links

Mature sequence gma-miR4415b-5p

Accession MIMAT0022997
Sequence

10 - 

aaguugugaugggaaucaauggca

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR4415b-3p

Accession MIMAT0021676
Previous IDsgma-miR4415b
Sequence

129 - 

uugauucucaucacaacaugg

 - 149

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).