Stem-loop sequence aca-let-7e

AccessionMI0018706 (change log)
DescriptionAnolis carolinensis let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7e
(1 sentences)

Stem-loop
   a       -   g   cu   gu         a      -  ------    cc 
5'  ugcuguc cuu agg  gag  aguagauug auaguu gu      ggag  u
    ||||||| ||| |||  |||  ||||||||| |||||| ||      ||||  u
3'  augacag gga ucc  uuc  ucaucuaac uaucaa cg      ccuc  a
   a       a   a   -u   ug         a      u  agucuc    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 123683599-123683700 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7e
aca-let-7echr4: 123683599-123683700 [-]
aca-let-7a-2chr4: 123683312-123683394 [-]
Database links

Mature sequence aca-let-7e-5p

Accession MIMAT0021701
Previous IDsaca-let-7e
Sequence

17 - 

ugagguaguagauugaauaguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7e-3p

Accession MIMAT0021702
Previous IDsaca-let-7e*
Sequence

64 - 

uaacuauacaaucuacugucuuuc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).